- Research
- Open access
- Published:
Impact of APOE ε4 and ε2 on plasma neurofilament light chain and cognition in autosomal dominant Alzheimer’s disease
Alzheimer's Research & Therapy volume 16, Article number: 208 (2024)
Abstract
Background
Apolipoprotein E (APOE) genotypes have been suggested to influence cognitive impairment and clinical onset in presenilin-1 (PSEN1) E280A carriers for autosomal dominant Alzheimer’s disease (ADAD). Less is known about their impact on the trajectory of biomarker changes. Neurofilament light chain (NfL), a marker of neurodegeneration, begins to accumulate in plasma about 20 years prior to the clinical onset of ADAD. In this study we investigated the impact of APOE ε4 and ε2 variants on age-related plasma NfL increases and cognition in PSEN1 E280A mutation carriers.
Methods
We analyzed cross-sectional data from PSEN1 E280A mutation carriers and non-carriers recruited from the Alzheimer’s Prevention Initiative Registry of ADAD. All participants over 18 years with available APOE genotype, plasma NfL, and neuropsychological evaluation were included in this study. APOE genotypes and plasma NfL concentrations were characterized for each participant. Cubic spline models using a Hamiltonian Markov chain Monte Carlo method were used to characterize the respective impact of at least one APOE ε4 or ε2 allele on age-related log-transformed plasma NfL increases. Linear regression models were estimated to explore the impact of APOE ε4 and ε2 variants and plasma NfL on a composite cognitive test score in the ADAD mutation carrier and non-carrier groups.
Results
Analyses included 788 PSEN1 E280A mutation carriers (169 APOE ε4 + , 114 ε2 +) and 650 mutation non-carriers (165 APOE ε4 + , 80 ε2 +), aged 18–75 years. APOE ε4 allele carriers were distinguished from ε4 non-carriers by greater age-related NfL elevations in the ADAD mutation carrier group, beginning about three years after the mutation carriers’ estimated median age at mild cognitive impairment onset. APOE ε2 allele carriers had lower plasma NfL concentrations than ε2 non-carriers in both the ADAD mutation carrier and non-carrier groups, unrelated to age, and an attenuated relationship between higher NfL levels on cognitive decline in the ADAD mutation carrier group.
Conclusions
APOE ε4 accelerates age-related plasma NfL increases and APOE ε2 attenuates the relationship between higher plasma NfL levels and cognitive decline in ADAD. NfL may be a useful biomarker to assess clinical efficacy of APOE-modifying drugs with the potential to help in the treatment and prevention of ADAD.
Background
Apolipoprotein E (APOE) genotype is the largest genetic component of sporadic Alzheimer’s disease (AD) risk. The ε4 allele (APOE ε4 +) is associated with increased disease risk and earlier disease onset, whereas presence of the ε2 allele (APOE ε2 +) confers protection [1, 2], and each additional copy of the ε4 or ε2 allele is associated with a higher and lower risk respectively [3]. Although autosomal dominant AD (ADAD) is genetically determined by mutations on the Presenilin-1 (PSEN1), PSEN2, or amyloid precursor protein genes, similar risk and protective effects of APOE observed in sporadic AD have been found in ADAD [4,5,6]. Previously, we showed that age-related trajectories of cognitive impairment are influenced by APOE ε4 and ε2 in members of the world’s largest kindred with ADAD due to a single mutation, PSEN1 E280A [4]. Mutation carriers who were also APOE ε4 + had accelerated onset of cognitive impairment, whereas those who were APOE ε2 + had delayed onset of cognitive impairment [4]. The underlying mechanisms of this relationship between APOE and cognition in ADAD remain to be further examined.
AD-associated neurodegeneration is closely related to clinical and cognitive impairment [7, 8]. A review of APOE genotype and neurodegeneration found consistent evidence that APOE ε4 + variants are associated with more extensive atrophy and neurodegeneration, typically measured through structural MRI measures [9]. However, biofluid markers of neurodegeneration are becoming increasingly common due to the lower cost and accessibility to broader populations. Neurofilament light chain (NfL) is a marker of axonal loss and neurodegeneration that can be measured through biofluids and is elevated in neurodegenerative diseases, including AD [10, 11]. Similarly to MRI markers of neurodegeneration, higher levels of NfL are associated with worse cognition and proximity to disease onset [12,13,14]. Plasma NfL levels distinguish PSEN1 E280A carriers from non-carriers more than two decades prior to clinical disease onset [15] and are associated with worse cognition and clinical progression [16].
Current research is inconclusive as to the relationships between APOE and plasma NfL concentrations in AD. In studies combining participants from various disease stages, one reported that APOE ε4 + participants had higher levels of NfL than those who were ε4- [17] and another that plasma NfL did not differ by APOE ε4, nor did APOE ε4 relate to NfL or progression from MCI to AD dementia [18]. Effects of APOE may differ depending on disease stage, such that including persons at all stages of disease may mask these effects. In support of this idea, a study examining cognitively unimpaired older adults found that plasma NfL was higher in APOE ε4 + than ε4- participants only after adjusting for age, sex, and education, and plasma NfL levels increased as a function of age most quickly in APOE ε4 homozygotes, with particularly steep accumulation between ages 75 and 85 [19]. Although most research has focused on the effects of APOE ε4, one study found that, compared to individuals with APOE ε3/ε3 variants, those who were APOE ε2 + had lower levels of plasma NfL, whereas APOE ε4 + individuals had similar levels of NfL compared to the ε3/ε3 group [20]. Thus, there is a need for additional research into the effects of both APOE ε4 and ε2 variants on plasma NfL concentrations, particularly examining accumulation across age. Further, these relationships have yet to be explored in ADAD populations.
In this study, we sought to examine the associations among plasma NfL, APOE variants, and cognition in carriers and non-carriers of the PSEN1 E280A mutation for ADAD. We hypothesized that mutation carriers who were also APOE ε4 + would have increased plasma NfL levels, whereas APOE ε2 + mutation carriers would have reduced levels. In addition, we hypothesized that APOE variant would moderate the effects of NfL on cognitive performance, such that ε4 + carriers would show a stronger NfL-cognition relationship and ε2 + carriers would have a weaker NfL-cognition relationship.
Methods
Participants
Participants were identified through the Alzheimer’s Prevention Initiative (API) Registry, consisting of family members of a Colombian kindred with a high incidence of the PSEN1 E280A mutation for ADAD. Participants were unaware of their own genetic status but had a parent who was known to carry the PSEN1 E280A mutation. All participants with plasma NfL and APOE genotyping above the age of 18 were included in this study, resulting in 788 PSEN1 E280A mutation carriers and 650 mutation non-carriers. A subset of these participants (674 PSEN1 E280A carriers, 594 mutation non-carriers) also had cognitive data.
Procedures and measures
Investigators were blind to participant genetic status during all collection and processing procedures.
Genomic DNA was extracted from the blood using standard protocols. PSEN1 E280A characterization was conducted at the University of Antioquia as described previously [21]. Genomic DNA was amplified with the primers PSEN1-S 5′ AACAGCTCAGGAGAGGAATG 3′ and PSEN1-AS 5′ GATGAGACAAGTNCCNTGAA 3′. We used the restriction enzyme BsmI for restriction fragment length polymorphism analysis. Each participant was classified as a PSEN1 E280A carrier or non-carrier. APOE genotyping was performed using a Kompetitive Allele Specific PCR – KASP™ assay [22] (LGV Genomics, Beverly, MA). APOE ε4 carriers were defined as individuals with at least one ε4 allele (APOE ε4 +), while non-carriers had no APOE ε4 alleles (APOE ε4-). APOE ε2 carriers had at least one ε2 allele (APOE ε2 +), while non-carriers had no APOE ε2 alleles (APOE ε2-). Sixteen PSEN1 carriers and 16 non-carriers who were APOE e2/e4 were included in both the e2 + and e4 + groups. The distribution of APOE variants is provided in Supplementary Table S1.
Three aliquots of 1 ml of plasma were collected in the morning (not fasting). Samples were stored at − 80˚C. One plasma aliquot was shipped on dry ice to the Clinical Neurochemistry Laboratory at Sahlgrenska University Hospital, Mölndal, Sweden for NfL analysis. NfL concentration was measured using an in-house Single molecule array (Simoa) assay, as previously described (manufacturer: Quanterix, Billerica, MA) [23]. The measurements were performed by board-certified laboratory technicians. One batch of reagents and one instrument was used to analyze the whole study.
Neuropsychological assessments were administered at the University of Antioquia in Spanish. Cognition was assessed using the API cognitive composite, a composite score derived from 5 neuropsychological tests that has been shown to be sensitive to early cognitive changes due to AD in this Colombian kindred [24]. The API composite includes CERAD Word List Recall, CERAD Boston Naming Test (high frequency), MMSE Orientation to Time, CERAD Constructional Praxis, and Ravens Progressive Matrices (Set A). The total cognitive composite score was calculated out of 100 with higher scores indicating better performance. Neuropsychological testing was performed within three months of the plasma collection.
Statistical analysis
All analyses were conducted in R (version 4.2.3). Effects of APOE were examined by comparing APOE ε4 + versus ε4- groups, and separately, APOE ε2 + versus ε2- groups. To address heavy skewness, log-transformed plasma NfL values were used in analyses. Differences in continuous demographic variables between APOE groups were conducted using two-sample t-tests (Levene’s test used to compare equality of variances). Chi-squared tests were used to examine differences in sex distribution. Group differences in plasma NfL were assessed using a factorial ANOVA, with PSEN1 and APOE group as independent variables, run with and without age and sex as covariates. Age-related trajectories of plasma NfL were modeled using a cubic spline model as a function of APOE group. Hamiltonian Markov chain Monte Carlo (MCMC) was used to model parameters with a 99% credible interval. Linear regression was used to examine APOE, plasma NfL, and their interaction in predicting API Composite scores. Regressions were run with and without age and sex as covariates. Supplementary analyses for plasma NfL group differences and linear regression were run comparing three APOE groups, excluding APOE ε2/ε4 participants: APOE e3/4 & ε4/4 versus ε3/ε3 versus ε2/ε3 & ε2/ε2 (Supplementary Tables S2, S3, Supplementary Figures S1, S2). Results were consistent with the two group comparisons reported in the main text.
Results
Participant characteristics
Participant demographics are provided in Table 1. A total of 788 PSEN1 E280A mutation carriers (169 APOE ε4 + , 609 APOE ε4-; 154 cognitively impaired carriers) and 650 mutation non-carrier family members (165 APOE ε4 + , 485 APOE ε4-) had plasma NfL and APOE genotype data collected. One PSEN1 E280A mutation carrier and 4 mutation non-carriers did not have education data available. Age, sex distribution, and education did not differ by APOE ε4 group. A subset of 674 PSEN1 E280A carriers (141 APOE ε4 + , 533 APOE ε4-) and 594 non-carriers had cognitive data (148 APOE ε4 + , 446 APOE ε4-). Within this subset, the APOE ε4 + group had higher years of education.
Among PSEN1 non-carriers, 650 (165 APOE ε4 + , 485 APOE ε4-) had plasma NfL and APOE collected, and a subset of 594 (148 APOE ε4 + , 446 APOE ε4-) also had cognitive data. Age, education, and sex distribution did not differ as a function of APOE ε4 group either in the full sample or subset with cognitive data (Table 1). Participant demographics as a function of APOE ε2 group are provided in Supplementary Table S4.
Associations between APOE ε4 and plasma NfL
We first examined the effects of PSEN1 and APOE ε4 on plasma NfL collapsing across age. Plasma NfL was higher in PSEN1 E280A carriers than in non-carriers (Table 1) [F (1, 1424) = 86.84, p < 0.001]. There was no main effect of APOE ε4 nor an interaction between APOE ε4 and PSEN1 genotypes on plasma NfL concentrations (Fig. 1A). Similar negative results were observed when including age and sex as covariates.
We then examined the accumulation of plasma NfL across age as a function of APOE ε4 using a restricted cubic spline model. Among PSEN1 E280A carriers, those who were also APOE ε4 + had greater age-related accumulation of plasma NfL beginning around age 47.5 compared to those who were APOE ε4- (Fig. 1B, C), the typical age between the onset of MCI and dementia in this cohort [25]. Age-related plasma NfL accumulation did not differ by APOE ε4 group in PSEN1 E280A mutation non-carriers in the sample’s specified age range (Fig. 1D, E).
Within the subset of PSEN1 E280A mutation carriers with cognitive data, higher plasma NfL was associated with lower scores on the API cognitive composite (ß = -0.60, p < 0.001). There was no main effect of APOE ε4 nor an interaction between APOE ε4 and plasma NfL on cognitive scores (Fig. 1F). When including age and sex as covariates, there was a non-significant trend for the NfL-cognition association to be stronger in APOE ε4 + carriers (NfL: ß = -0.24, p < 0.001; APOE ε4: ß = 0.17, p = 0.059; NfL x APOE ε4 interaction: ß = -0.18, p = 0.054).
In PSEN1 E280A mutation non-carriers, there was no main effect of APOE ε4, but plasma NfL was inversely associated with API composite scores (ß = -0.11, p = 0.031), and APOE ε4 moderated the association between NfL and cognition (ß = 0.29, p = 0.033; Fig. 1G). These relationships did not remain statistically significant when including age and sex as covariates.
Associations between APOE ε2 and plasma NfL
Collapsing across age, plasma NfL accumulation was higher in PSEN1 E280A mutation carriers than non-carriers, but there were no group differences by APOE ε2 nor an interaction between PSEN1 and APOE genotypes (Fig. 2A). When including age and sex in the model, however, the main effect of APOE ε2 was significant, such that participants who were APOE ε2 + had lower levels of plasma NfL than those who were APOE ε2-, in both the PSEN1 mutation carrier and non-carrier groups [PSEN1: F(1, 1422) = 198.43, p < 0.001); APOE ε2: F(1, 1422) = 5.92, p = 0.015; PSEN1 x APOE ε2 interaction: F(1, 1422) = 1.70, p = 0.192; age: F(1, 1422) = 1204.31, p < 0.001; sex: F(1, 1422) = 10.97, p = . 001]. The age-related trajectories of plasma NfL accumulation did not differ by APOE ε2 group in PSEN1 E280A mutation carriers or non-carriers (Fig. 2B-E).
In PSEN1 E280A mutation carriers with cognitive data, both higher plasma NfL and being APOE ε2- were associated with lower API Composite scores (Fig. 2F; NfL: ß = -0.67, p < 0.001; APOE ε2-: ß = -0.26, p = 0.004). Further, APOE ε2 moderated the effect of plasma NfL on cognition, such that the negative association between plasma NfL and cognition was attenuated in APOE ε2 + PSEN1 E280A mutation carriers (ß = 0.29, p = 0.001). Results were consistent when including age and sex as covariates. In PSEN1 E280A mutation non-carriers, both NfL and being APOE ε2- were associated with lower cognitive scores (NfL: ß = -0.10, p = 0.033; APOE ε2-: ß = -0.30, p = 0.008), and APOE ε2 moderated the NfL-cognition relationship (ß = 0.24, p = 0.037). The main effect of NfL and the interaction between NfL and APOE were not statistically significant after including age and sex in the model, but being APOE ε2- remained associated with lower cognitive scores (ß = -0.28, p = 0.013) (Fig. 2G).
The findings from further analyses, which excluded three non-carrier outliers, remained consistent with the initial results and are presented in Supplementary Table S6 and Figures S4 and S5.
Discussion
Although most carriers of the PSEN1 E280A mutation for ADAD are genetically determined to develop AD dementia by midlife, we previously found that APOE influences age-related trajectories of cognitive impairment [4]. We also showed that plasma NfL levels can distinguish PSEN1 E280A carriers from non-carriers about twenty years before symptoms appear [15]. Here, we showed that APOE ε4 and ε2 variants influence age-related accumulation of plasma NfL, shown previously to increase decades prior to clinical onset in this kindred [15]. Plasma NfL concentrations distinguished PSEN1 mutation carriers who also had an APOE ε4 allele from those without an ε4 allele beginning at age 47, several years after the median age of onset of MCI (44 years) but prior to the estimated onset of dementia (49 years) in this kindred [25], whereas presence of the APOE ε2 allele was associated with lower plasma NfL concentrations regardless of age. Additionally, our findings support the possibility that APOE ε2 has protective effects against NfL-associated cognitive impairment.
Prior findings on the role of APOE genotype on NfL accumulation have been mixed. Studies of plasma and CSF concentrations of NfL report findings ranging from higher concentrations in APOE ε4 + variants, to no difference by APOE genotype, and lower concentrations in APOE ε4 + variants [17,18,19, 26, 27]. These inconsistent findings suggest that group-wide differences in NfL concentrations may not be consistent across age or disease stage. Our results examining effects of APOE ε4 across age indicate that differences emerge in prodromal disease stages, between the onset of MCI and clinical dementia. These results are consistent with a recent study showing increased NfL accumulation in APOE ε4 + adults beginning in older adulthood [19].
Contrary to our hypotheses, and despite APOE ε4 + PSEN1 mutation carriers exhibiting greater age-related increases in plasma NfL, APOE ε4 was not associated with worse cognition nor did it moderate the relationship between NfL and cognition in this sample. These associations neared significance after adjusting for age and sex, suggesting that the effects of APOE ε4 on NfL-related cognitive impairment may also be age-dependent, similar to our findings characterizing group-level NfL concentrations versus age-related trajectories. Comparisons of the full study sample with the subset with cognitive data revealed that participants who had plasma NfL but not cognitive data were older and had higher levels of NfL than the subset of participants who had all available data (Supplementary Table 5). Coupled with our findings that APOE ε4 carriers begin to accumulate more NfL in later disease stages, APOE ε4 may only moderate the NfL-cognition relationship in later disease stages which is not represented in the subset of participants with cognitive data. Another possibility is that the effects of APOE ε4 on cognition are less evident because the APOE ε4 accelerated accumulation is occurring later in the disease process when there’s already considerable AD pathology and possible neurodegeneration. Indeed, higher plasma NfL has been associated with higher PET-measured tau pathology and lower MRI-measured MTL volume [16, 19].
Conversely, APOE ε2 did not influence age-related trajectories of NfL accumulation but was associated with lower levels of plasma NfL on average and attenuated cognitive impairment associated with higher levels of NfL. The protective effects of APOE ε2 may begin earlier in life, thereby contributing to overall group differences but not in rates of accumulation across advancing age. Additionally, the cognitive benefits of the APOE ε2 + variant may have been more evident in the subset of participants with cognitive data, who were on average younger than the full study sample. These results suggest the APOE ε2 allele may provide resilience to cognitive impairment associated with neurodegeneration. These results are consistent with prior reports of a protective effect of APOE ε2 in AD [4, 6, 28]; however, to our knowledge, these are the first results reporting a protective effect of APOE ε2 in the context of NfL-associated cognitive impairment.
Our findings suggest a role of APOE ε4 and ε2 alleles on biofluid markers of neurodegeneration in PSEN1 E280A mutation carriers. Potential pathophysiological mechanisms that explain how APOE ε4 impacts biofluid markers of neurodegeneration, such as NfL, may include the activation of microglia to induce neuroinflammation, leading directly to neuronal degeneration, or influencing amyloid-β and tau pathology.
These results need to be interpreted with caution, as the relatively large sample size may lead to the detection of significance even with small effect sizes. Replication in independent samples is required, and further investigation is needed to determine the generalizability to sporadic AD and other ADAD mutations. However, there are several strengths of assessing these questions in ADAD. Plasma NfL concentrations increase with age and non-AD neurodegenerative diseases, making it difficult to isolate AD-specific accumulation in the general population. Because carriers of the PSEN1 E280A are younger than their sporadic AD counterparts and are known to be developing AD-dementia, our findings are unlikely to be driven by age-related and we can more closely assess AD-specific changes. This study also has several limitations. Due to low numbers of homozygous APOE ε2 and ε4 carriers, we were not able to assess whether the pattern of results differ based on the number of copies of APOE ε2 and ε4 alleles. Additionally, this study is cross-sectional. Although PSEN1 E280A carriers follow a well-defined disease trajectory, there are sources of individual variability. Future studies should examine longitudinal measures of plasma NfL accumulation and cognition.
In conclusion, APOE influences age-related accumulation of plasma NfL, and presence of the APOE ε2 allele may provide protection against cognitive impairment associated with neurodegeneration. These findings contribute to the growing evidence that APOE influences the trajectory of ADAD and provides further support for the development of APOE-based therapeutics for both autosomal dominant and sporadic forms of the disease. Further analyses are required to determine the number of PSEN1 + APOE ε4 + versus PSEN1 + APOE ε4- mutation carriers showing elevated NfL levels needed to demonstrate the significant effects of AD-modifying treatments on NfL reduction. These findings will inform the design of future treatment and prevention trials within this family, potentially optimizing the size and duration of early phase trials involving this population.
Availability of data and materials
Anonymized clinical, genetic, and imaging data are available upon request, subject to an internal review by YTQ and FL to ensure that the participants’ anonymity, confidentiality, and PSEN1 E280a carrier or non-carrier status are protected. Data requests will be considered based on a proposal review, and completion of a data sharing agreement, in accordance with the University of Antioquia and MGH institutional guidelines.
Data availability
Source data will be available with this paper including age, log-transformed plasma NfL concentrations, API composite scores, and genetic group. The data analyzed in this study are not made publicly available in full to protect the identities of members of this kindred. The datasets will be made available from the corresponding author on request.
References
Roses Allen DMD. Apolipoprotein E alleles as risk factors in Alzheimer’s disease. Annu Rev Med. 1996;47(1):387–400.
Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC, Small GW, et al. Gene Dose of Apolipoprotein E Type 4 Allele and the Risk of Alzheimer’s Disease in Late Onset Families. Science (80- ). 1993;261(5123):921–3. Available from: https://science.sciencemag.org/content/261/5123/921.
Reiman EM, Arboleda-Velasquez JF, Quiroz YT, Huentelman MJ, Beach TG, Caselli RJ, et al. Exceptionally low likelihood of Alzheimer’s dementia in APOE2 homozygotes from a 5,000-person neuropathological study. Nat Commun. 2020;11(1):667. Available from: http://www.nature.com/articles/s41467-019-14279-8.
Langella S, Barksdale NG, Vasquez D, Aguillon D, Chen Y, Su Y, et al. Effect of apolipoprotein genotype and educational attainment on cognitive function in autosomal dominant Alzheimer’s disease. Nat Commun. 2023;14(1):5120 https://doi.org/10.1038/s41467-023-40775-z.
Pastor P, Roe CM, Villegas A, Bedoya G, Chakraverty S, García G, et al. Apolipoprotein Eε4 modifies Alzheimer’s disease onset in an E280A PS1 kindred. Ann Neurol. 2003;54(2):163–9.
Vélez JI, Lopera F, Sepulveda-Falla D, Patel HR, Johar AS, Chuah A, et al. APOE∗E2 allele delays age of onset in PSEN1 E280A Alzheimer’s disease. Mol Psychiatry. 2016;21(7):916–24.
Bejanin A, Schonhaut DR, La Joie R, Kramer JH, Baker SL, Sosa N, et al. Tau pathology and neurodegeneration contribute to cognitive impairment in Alzheimer’s disease. Brain. 2017;140(12):3286–300. https://doi.org/10.1093/brain/awx243.
Terry RD, Masliah E, Salmon DP, Butters N, DeTeresa R, Hill R, et al. Physical basis of cognitive alterations in Alzheimer’s disease: synapse loss is the major correlate of cognitive impairment. Ann Neurol. 1991;30(4):572–80.
Tzioras M, Davies C, Newman A, Jackson R, Spires‐Jones T. Invited Review: APOE at the interface of inflammation, neurodegeneration and pathological protein spread in Alzheimer’s disease. Neuropathol Appl Neurobiol. 2019;45(4):327–46. Available from: https://onlinelibrary.wiley.com/doi/10.1111/nan.12529.
Gaetani L, Blennow K, Calabresi P, Di Filippo M, Parnetti L, Zetterberg H. Neurofilament light chain as a biomarker in neurological disorders. J Neurol Neurosurg Psychiatry. 2019;90(8):870–81. Available from: https://jnnp.bmj.com/lookup/doi/10.1136/jnnp-2018-320106.
Weston PSJ, Poole T, Ryan NS, Nair A, Liang Y, Macpherson K, et al. Serum neurofilament light in familial Alzheimer disease. Neurology. 2017;89(21):2167 LP – 2175. Available from: http://n.neurology.org/content/89/21/2167.abstract.
Jin M, Cao L, Dai Y. Role of Neurofilament light chain as a potential biomarker for alzheimer’s disease: a correlative meta-analysis. Front Aging Neurosci. 2019;11. https://doi.org/10.3389/fnagi.2019.00254.
Ramani S, Berard JA, Walker LAS, The relationship between neurofilament light chain and cognition in neurological disorders: A scoping review. J Neurol Sci. 2021;420(November 2020):117229. Available from: https://doi.org/10.1016/j.jns.2020.117229.
Johansson C, Thordardottir S, Laffita-Mesa J, Rodriguez-Vieitez E, Zetterberg H, Blennow K, et al. Plasma biomarker profiles in autosomal dominant Alzheimer’s disease. Brain. 2023;146(3):1132–40. Available from: https://doi.org/10.1093/brain/awac399.
Quiroz YT, Zetterberg H, Reiman EM, Chen Y, Su Y, Fox-Fuller JT, et al. Plasma neurofilament light chain in the presenilin 1 E280A autosomal dominant Alzheimer’s disease kindred: a cross-sectional and longitudinal cohort study. Lancet Neurol. 2020;19(6):513–21. Available from: https://doi.org/10.1016/S1474-4422(20)30137-X.
Guzmán‐Vélez E, Zetterberg H, Fox‐Fuller JT, Vila‐Castelar C, Sanchez JS, Baena A, et al. Associations between plasma neurofilament light, in vivo brain pathology, and cognition in non‐demented individuals with autosomal‐dominant Alzheimer’s disease. Alzheimer’s Dement. 2021;17(5):813–21. https://alz-journals.onlinelibrary.wiley.com/doi/10.1002/alz.12248.
Giacomucci G, Mazzeo S, Bagnoli S, Ingannato A, Leccese D, Berti V, et al. Plasma neurofilament light chain as a biomarker of Alzheimer’s disease in Subjective Cognitive Decline and Mild Cognitive Impairment. J Neurol. 2022;269(8):4270–80. https://doi.org/10.1007/s00415-022-11055-5.
Lin Y-S, Lee W-J, Wang S-J, Fuh J-L, Levels of plasma neurofilament light chain and cognitive function in patients with Alzheimer or Parkinson disease. Sci Rep. 2018;26;8(1):17368. Available from: https://doi.org/10.1038/s41598-018-35766-w.
Malek-Ahmadi M, Su Y, Ghisays V, Luo J, Devadas V, Chen Y, et al. Plasma NfL is associated with the APOE ε4 allele, brain imaging measurements of neurodegeneration, and lower recall memory scores in cognitively unimpaired late-middle-aged and older adults. Alzheimers Res Ther. 2023;15(1):74. Available from: https://alzres.biomedcentral.com/articles/https://doi.org/10.1186/s13195-023-01221-w.
Fani L, Ahmad S, Ikram MK, Ghanbari M, Ikram MA. Immunity and amyloid beta, total tau and neurofilament light chain: Findings from a community‐based cohort study. Alzheimer’s Dement. 2021;17(3):446–56. Available from: https://alz-journals.onlinelibrary.wiley.com/doi/https://doi.org/10.1002/alz.12212.
Lendon CL, Martinez A, Behrens IM, Kosik KS, Madrigal L, Norton J, et al. E280A PS-1 mutation causes Alzheimer’s disease but age of onset is not modified by ApoE alleles. Hum Mutat. 1997;10(3):186–95. https://doi.org/10.1002/(SICI)1098-1004(1997)10:3%3C186::AID-HUMU2%3E3.0.CO;2-H.
He C, Holme J, Anthony J. SNP Genotyping: The KASP Assay BT - crop breeding: methods and protocols. In: Fleury D, Whitford R, editors. Methods in Molecular Biology. New York, NY: Springer New York; 2014. p. 75–86. https://doi.org/10.1007/978-1-4939-0446-4_7.
Gisslén M, Price RW, Andreasson U, Norgren N, Nilsson S, Hagberg L, et al. Plasma Concentration of the Neurofilament Light Protein (NFL) is a Biomarker of CNS Injury in HIV Infection: A Cross-Sectional Study. EBioMedicine. 2016;3:135–40.
Ayutyanont N, Langbaum JBS, Hendrix SB, Chen K, Fleisher AS, Friesenhahn M, et al. The Alzheimer’s prevention initiative composite cognitive test score: sample size estimates for the evaluation of preclinical Alzheimer’s disease treatments in presenilin 1 E280A mutation carriers. J Clin Psychiatry. 2014;75(6):652–60.
Acosta-Baena N, Sepulveda-Falla D, Lopera-Gómez CM, Jaramillo-Elorza MC, Moreno S, Aguirre-Acevedo DC, et al. Pre-dementia clinical stages in presenilin 1 E280A familial early-onset Alzheimer’s disease: a retrospective cohort study. Lancet Neurol. 2011;10(3):213–20. https://doi.org/10.1016/S1474-4422(10)70323-9.
Zetterberg H, Skillbäck T, Mattsson N, Trojanowski JQ, Portelius E, Shaw LM, et al. Association of Cerebrospinal Fluid Neurofilament Light Concentration With Alzheimer Disease Progression. JAMA Neurol. 2016;73(1):60–7. https://doi.org/10.1001/jamaneurol.2015.3037.
Mattsson N, Eriksson O, Lindberg O, Schöll M, Lampinen B, Nilsson M, et al. Effects of APOE ε4 on neuroimaging, cerebrospinal fluid biomarkers, and cognition in prodromal Alzheimer’s disease. Neurobiol Aging. 2018;71:81–90. Available from: https://www.sciencedirect.com/science/article/pii/S0197458018302549.
Sweigart B, Andersen SL, Gurinovich A, Cosentino S, Schupf N, Perls TT, et al. APOE E2/E2 Is Associated with Slower Rate of Cognitive Decline with Age. J Alzheimers Dis. 2021;83(2):853–60.
Acknowledgements
The authors thank the PSEN1 Colombian families for contributing their valuable time and effort, without which this study would not have been possible. We thank the research staff of the Group of Neuroscience of Antioquia for their help coordinating study visits for the Colombian API Registry. We thank Geidy Serrano from the Banner institute for her help quantifying DNA samples.
Author information
Authors and Affiliations
Contributions
Y.T.Q., F.L., and E.M.R. initiated this work and supervised conduction of the study. S.L., K.B., and Y.T.Q. drafted the manuscript. Genetic data were collected and analyzed by G.G-O., C.G-M., K.K. and J.F.A.-V. Clinical information were collected and analyzed by D.A., D.V., M.G-C., A.Y.B., C.M., V.T., N.A-B, S.R-R and F.L. Statistical analyses were conducted by S.L., Y.C, V.G., J.P., P.T., and Y.S. SL and YC prepared figures. All co-authors reviewed and contributed to finalize the manuscript.
Corresponding author
Ethics declarations
Competing interests
S.L. is supported by a grant from the Alzheimer’s Association (AARF-22–920754). Y.S. reports grants from The Alzheimer’s Association, The BrightFocus Foundation, NIH/NIA, State of Arizona, outside the submitted work. C.V.-C. reports grants from the Alzheimer’s Association (AARF 2019A005859) and the National Institute on Aging (K99AG073452). J.J.P. was supported by the Arizona Department of Health Services (CTR057001). K.S.K. is on the Board of Directors for the Tau Consortium, receives funding from the NIA, the Alzheimer Association, and the Alzheimer’s Drug Discovery Foundation. P.N.T. reports receiving consulting fees from AbbVie, AC Immune, Acadia, Athira, Axsome, Biogen, BioXcel, Corium, Cortexyme, CuraSen, Eisai, Genentech, Immunobrain, Lundbeck, Novo Nordisk, Otsuka & Astex, Merck & Co., Novo Nordisk, Syneos, and T3D Therapeutics. E.M.R. and P.N.T. report grants from National Institute on Aging (P30 AG072980, R01 AG069453, R01 AG055444), Banner Alzheimer’s Foundation and the NOMIS Foundation during the conduct of the study. E.M.R. is a compensated scientific advisor for Alzheon, Aural Analytics, Denali, Retromer Therapeutics, and Vaxxinity, an uncompensated scientific advisor for Lilly, and a cofounder, advisor and shareholder of AlzPATH, which is involved in the development of blood-based biomarkers for Alzheimer’s disease outside the scope of the submitted. In addition, E.M.R. is the inventor of a patent issued to Banner Health, which involves the use of biomarker endpoints in at-risk persons to accelerate the evaluation of Alzheimer’s disease prevention therapies and is outside the submitted work. F.L. was supported by an Anonymous Foundation, and the Administrative Department of Science, Technology and Innovation (Colciencias Colombia;111565741185). E.M.R., F.L., and P.N.T. are principal investigators of the Alzheimer’s Prevention Initiative (API) Autosomal Dominant AD Trial, which is supported by NIA, philanthropy, Genentech, and Roche. E.M.R was supported by grants from the NIA (R01 AG069453, P30 AG072980, RF1AG041705 and R01 AG055444). Y.T.Q. was supported by grants from the National Institute on Aging (R01 AG054671, RF1AG077627, RM1NS132996, U01AG087103), the Alzheimer’s Association, and Massachusetts General Hospital ECOR. Y.T.Q. serves as consultant for Biogen. The remaining authors declare no competing interests.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
About this article
Cite this article
Langella, S., Bonta, K., Chen, Y. et al. Impact of APOE ε4 and ε2 on plasma neurofilament light chain and cognition in autosomal dominant Alzheimer’s disease. Alz Res Therapy 16, 208 (2024). https://doi.org/10.1186/s13195-024-01572-y
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s13195-024-01572-y