Skip to main content

Table 2 Information of qRT-PCR primers used in this study

From: A selective p38α/β MAPK inhibitor alleviates neuropathology and cognitive impairment, and modulates microglia function in 5XFAD mouse

Gene name NCBI reference Forward primer (5′ → 3′) Reverse primer (5′ → 3′)
TNF-α NM_013693 GATTATGGCTCAGGGTCCAA GCTCCAGTGAATTCGGAAAG
IL-1β NM_008361 CCCAAGCAATACCCAAAGAA GCTTGTGCTCTGCTTGTGAG
IL-6 NM_031168 CCGGAGAGGAGACTTCACAG TTGCCATTGCACAACTCTTT
Arg1 NM_007482 AGTTGGGTTCACTTCCATGA CGATTCACCTGAGCTTTGAT
YM-1 NM_009892 AGAGCAAGAAACAAGCATGG CTGTACCAGCTGGGAAGAAA
Fizz NM_020509 TCCAGCTAACTATCCCTCCACTGT GGCCCATCTGTTCATAGT
MACRO NM_010766 CTGTGGCAATGGATCACTAGC CTCCTGGCTGGTATGGACC
Msr1 NM_031195 TGAACGAGAGGATGCTGACTG GGAGGGGCCATTTTTAGTGC
SCARB1 NM_016741 TTTGGAGTGGTAGTAAAAAGGGC TGACATCAGGGACTCAGAGTAG
SCARB3 NM_007643 GAACCACTGCTTTCAAAAACTGG TGCTGTTCTTTGCCACGTCA
GAPDH NM_008084 TGAATACGGCTACAGCAACA AGGCCCCTCCTGTTATTATG