Skip to main content

Table 2 Information of qRT-PCR primers used in this study

From: A selective p38α/β MAPK inhibitor alleviates neuropathology and cognitive impairment, and modulates microglia function in 5XFAD mouse

Gene nameNCBI referenceForward primer (5′ → 3′)Reverse primer (5′ → 3′)
TNF-αNM_013693GATTATGGCTCAGGGTCCAAGCTCCAGTGAATTCGGAAAG
IL-1βNM_008361CCCAAGCAATACCCAAAGAAGCTTGTGCTCTGCTTGTGAG
IL-6NM_031168CCGGAGAGGAGACTTCACAGTTGCCATTGCACAACTCTTT
Arg1NM_007482AGTTGGGTTCACTTCCATGACGATTCACCTGAGCTTTGAT
YM-1NM_009892AGAGCAAGAAACAAGCATGGCTGTACCAGCTGGGAAGAAA
FizzNM_020509TCCAGCTAACTATCCCTCCACTGTGGCCCATCTGTTCATAGT
MACRONM_010766CTGTGGCAATGGATCACTAGCCTCCTGGCTGGTATGGACC
Msr1NM_031195TGAACGAGAGGATGCTGACTGGGAGGGGCCATTTTTAGTGC
SCARB1NM_016741TTTGGAGTGGTAGTAAAAAGGGCTGACATCAGGGACTCAGAGTAG
SCARB3NM_007643GAACCACTGCTTTCAAAAACTGGTGCTGTTCTTTGCCACGTCA
GAPDHNM_008084TGAATACGGCTACAGCAACAAGGCCCCTCCTGTTATTATG