Skip to main content

Advertisement

Table 1 Real-time PCR primers and MGB Fam-TaqMan probes for NRXN3 isoforms

From: Neurexin 3 transmembrane and soluble isoform expression and splicing haplotype are associated with neuron inflammasome and Alzheimer’s disease

NRXN3 Forward primers Reverse primers MGB probes
Hs01028186_m1 NRXN3 TaqMan gene expression assay   
ex 22a24a TGATCTTGTTTCATCTGCTGAATG AAGGTGCACGAGTAGCAATAG CCGAGTACAGGAGGTG
ex 22a24b TGATCTTGTTTCATCTGCTGAATG TGCTTTGTAGCCACCTTCGA CCGAGTACAGATAAGAGTC
ex 22a24c TGATCTTGTTTCATCTGCTGAATG CCCGGAACCCGTCTGATT CCGAGTACAGCAAAC
ex 22a23a AGATGATCTTGTTTCATCTGCTGAA CGGAGTGATCTAGCTGCATTAGAG CCGAGTACAGCCAGAAG
ex α1-2 GACATACAGACAGATCCCAAATCTTC TCATGGTGCGGCCAGAA AACTGGAAAGGTCTTTTC
ex β1-18 TTCCCCTGTTTCCCTTCGA GCCCACCACTTTTCCCAAA AGGACACGCTGGCG